Homework

Homework Questions? Ask a Tutor for Answers ASAP

Connect one-on-one with {0} who will answer your question

Related Homework Questions
1) For the lactose operon to turn on--which of the following
1) For the lactose operon to turn on--which of the following conditions must be met (choose all that apply)glucose must be absentglucose must be presentlactose must be presentcAMP levels are lowcAMP l… read more
STEM_Tutor
STEM_Tutor
Doctoral Degree
568 satisfied customers
Using the following DNA sequence, come up with your own
Using the following DNA sequence, come up with your own corresponding sequence after a 1) point mutation and 2) frameshift mutation. Also write out the corresponding RNA sequence: AGTAAACGTACCTGAGACGG… read more
Jaun
Jaun
Lecturer
Master's Degree
1,869 satisfied customers
I have a biology question I need help with. Need help on
Need help on biology question regarding transconjugants … read more
Homeworkexpert12
Homeworkexpert12
Freelance Homework Expert
Master's Degree
922 satisfied customers
Please answer these critical thinking Questions by using only
Please answer these critical thinking Questions by using only the text, Microbiology by Robert W. Bauman. Due date is tomorrow. 1. A microbiologist describes an organism as a chemoheterotrophic, aerot… read more
Mr. Gregory White
Mr. Gregory White
1,269 satisfied customers
1. Ribosomal RNA (Points : 4) covalently binds amino
1. Ribosomal RNA (Points : 4) covalently binds amino acids. contains an anticodon. is produced in the nucleolus of the nucleus. assists in DNA replication. has no known function in the cell. 2. A tiny… read more
Ellen
Ellen
Attorney
Doctoral Degree
650 satisfied customers
This is a entry Biology gene project $40 Bonus need Sunday
This is a entry Biology gene project $40 Bonus need Sunday by 9pm EST. Complete all three parts and answer all questions. Download Graphic Organizer for answering all questions and genetics exercises … read more
asciandwildlifebio
asciandwildlifebio
PhD Student, Environmental Sciences
1,406 satisfied customers
Learning Outcome #1, #2, #3 & 4– DNA, RNA, Transcription &
Learning Outcome #1, #2, #3 & 4– DNA, RNA, Transcription & Translation 1. What are the base pairs in DNA? 2. What is meant by a double helix? To what common object is it often compared? What are the “… read more
asciandwildlifebio
asciandwildlifebio
PhD Student, Environmental Sciences
1,406 satisfied customers
Discuss, in detail, the role played by DNA and RNA in genetic
Discuss, in detail, the role played by DNA and RNA in genetic diseases. What are the breakthroughs, if any, in the treatment/management of genetic diseases?… read more
Chelsea
Chelsea
Professional Tutor
Master's Degree
271 satisfied customers
Consider the following mutants. For each mutant identify the
Consider the following mutants. For each mutant identify the most likely DNA sequence element, RNA, Enzyme or protein that is defective, and explain why 1) During transcription of a prokaryotic gene t… read more
BMW MD
BMW MD
Post-Doctoral Degree
1,051 satisfied customers
Learning Outcome #1 Digestive and Circulatory Systems1. &
Learning Outcome #1 – Digestive and Circulatory Systems 1. The esophagus is a member of the digestive system, why is it not considered an active member (chemically)? 2. In the digestive system, which … read more
BMW MD
BMW MD
Post-Doctoral Degree
1,051 satisfied customers
Learning Outcome #1, #2, #3 & 4 DNA, RNA, Transcription &
Learning Outcome #1, #2, #3 & 4– DNA, RNA, Transcription & Translation 1. What are the base pairs in DNA? 2. What is meant by a double helix? To what common object is it often compared? What are the “… read more
KErickson
KErickson
fellow
Doctoral Degree
106 satisfied customers
How can I explain some interaction between hormones and behavior
How can I explain some interaction between hormones and behavior in Adult Sexual Development and Tell tell how this interaction affects the development of adult sexuality. I need it ASAP.… read more
Safa Khan
Safa Khan
Master's Degree
63 satisfied customers
Taxol is a trade name. What is the generic” name for this
Taxol is a trade name. What is the “generic” name for this compound? Who was awarded this trademark and what was the controversy surrounding this assignment? 2. What part of the European Yew acts as t… read more
KErickson
KErickson
fellow
Doctoral Degree
106 satisfied customers
Part 1 Genetics From Genes to Proteins Convert the following
Part 1: Genetics: From Genes to Proteins Convert the following DNA sequence into its RNA equivalent and then using the genetic code, convert that RNA sequence into the amino acid sequence. 5'–TACTTCTT… read more
vidya suman
vidya suman
Master's Degree
Bio2400 ( microbiology) This is the final homework ...
Bio2400 ( microbiology) This is the final homework and is worth a large percentage of your grade in the class, so take the time to do a good job. Read each question VERY carefully and pay attention to… read more
Jen
Jen
DON Residential Home, School Nurse
Nursing Diploma
114 satisfied customers
i cant seem to memorize anymore i am taking microbioliogy ...
i cant seem to memorize anymore i am taking microbioliogy and cant seen to maintain information any suggesdtions how i can retain info?… read more
jkneeazd
jkneeazd
HS Biology, Anat/Phys, Phy SciTeacher
Master Degree
24 satisfied customers
Why do cells express only some of the proteins encoded in ...
Why do cells express only some of the proteins encoded in the genetic material and how is it regulated?… read more
Lauren N
Lauren N
Tutor
Bachelor Degree
34 satisfied customers
Why is the catabolite activator protein interaction in ...
Why is the catabolite activator protein interaction in the lac operon a more relistic model than the lac repressor story for control of trnscription in eukaryotes… read more
xarqi
xarqi
284 satisfied customers
Disclaimer: Information in questions, answers, and other posts on this site ("Posts") comes from individual users, not JustAnswer; JustAnswer is not responsible for Posts. Posts are for general information, are not intended to substitute for informed professional advice (medical, legal, veterinary, financial, etc.), or to establish a professional-client relationship. The site and services are provided "as is" with no warranty or representations by JustAnswer regarding the qualifications of Experts. To see what credentials have been verified by a third-party service, please click on the "Verified" symbol in some Experts' profiles. JustAnswer is not intended or designed for EMERGENCY questions which should be directed immediately by telephone or in-person to qualified professionals.

JustAnswer in the News:

Ask-a-doc Web sites: If you've got a quick question, you can try to get an answer from sites that say they have various specialists on hand to give quick answers... Justanswer.com.
JustAnswer.com...has seen a spike since October in legal questions from readers about layoffs, unemployment and severance.
Web sites like justanswer.com/legal
...leave nothing to chance.
Traffic on JustAnswer rose 14 percent...and had nearly 400,000 page views in 30 days...inquiries related to stress, high blood pressure, drinking and heart pain jumped 33 percent.
Tory Johnson, GMA Workplace Contributor, discusses work-from-home jobs, such as JustAnswer in which verified Experts answer people’s questions.
I will tell you that...the things you have to go through to be an Expert are quite rigorous.

What Customers are Saying:

Wonderful service, prompt, efficient, and accurate. Couldn't have asked for more. I cannot thank you enough for your help.

Mary C.Freshfield, Liverpool, UK

This expert is wonderful. They truly know what they are talking about, and they actually care about you. They really helped put my nerves at ease. Thank you so much!!!!

AlexLos Angeles, CA

Thank you for all your help. It is nice to know that this service is here for people like myself, who need answers fast and are not sure who to consult.

GPHesperia, CA

I couldn't be more satisfied! This is the site I will always come to when I need a second opinion.

JustinKernersville, NC

Just let me say that this encounter has been entirely professional and most helpful. I liked that I could ask additional questions and get answered in a very short turn around.

EstherWoodstock, NY

Thank you so much for taking your time and knowledge to support my concerns. Not only did you answer my questions, you even took it a step further with replying with more pertinent information I needed to know.

RobinElkton, Maryland

He answered my question promptly and gave me accurate, detailed information. If all of your experts are half as good, you have a great thing going here.

DianeDallas, TX

< Previous | Next >

Meet the Experts:

Scott

Scott

MIT Graduate

5,558 satisfied customers

MIT Graduate (Math, Programming, Science, and Music)

LogicPro

LogicPro

Engineer

18,409 satisfied customers

Expert in Python,Java C++ C C# VB Javascript Design SQL HTML

Manal Elkhoshkhany

Manal Elkhoshkhany

Tutor

4,775 satisfied customers

More than 5000 online tutoring sessions.

Linda_us

Linda_us

Finance, Accounts & Homework Tutor

3,138 satisfied customers

Post Graduate Diploma in Management (MBA)

Chris M.

Chris M.

M.S.W. Social Work

2,852 satisfied customers

Master's Degree, strong math and writing skills, experience in one-on-one tutoring (college English)

F. Naz

F. Naz

Chartered Accountant

2,273 satisfied customers

Experience with chartered accountancy

Bizhelp

Bizhelp

CPA

1,887 satisfied customers

Bachelors Degree and CPA with Accounting work experience

< Previous | Next >

Disclaimer: Information in questions, answers, and other posts on this site ("Posts") comes from individual users, not JustAnswer; JustAnswer is not responsible for Posts. Posts are for general information, are not intended to substitute for informed professional advice (medical, legal, veterinary, financial, etc.), or to establish a professional-client relationship. The site and services are provided "as is" with no warranty or representations by JustAnswer regarding the qualifications of Experts. To see what credentials have been verified by a third-party service, please click on the "Verified" symbol in some Experts' profiles. JustAnswer is not intended or designed for EMERGENCY questions which should be directed immediately by telephone or in-person to qualified professionals.

Show MoreShow Less

Ask Your Question

x