How JustAnswer Works:

  • Ask an Expert
    Experts are full of valuable knowledge and are ready to help with any question. Credentials confirmed by a Fortune 500 verification firm.
  • Get a Professional Answer
    Via email, text message, or notification as you wait on our site.
    Ask follow up questions if you need to.
  • 100% Satisfaction Guarantee
    Rate the answer you receive.

Ask Scott Your Own Question

Scott
Scott, MIT Graduate
Category: Homework
Satisfied Customers: 3040
Experience:  MIT Graduate (Math, Programming, Science, and Music)
3546829
Type Your Homework Question Here...
Scott is online now
A new question is answered every 9 seconds

3. This is an mRNA sequence for the name of a protein found

Customer Question

3.     This is an mRNA sequence for the name of a protein found throughout your body:

5' A AG G G U G U A G A A G C U A A G G G U 3'

a.     What is the informational DNA sequence that encodes for the word for this protein? Be sure to note the 5' and 3' ends.

Your answer:


b.     What is the antisense DNA sequence that would be found in the template strand for the information sequence that you submitted as an answer for the previous question? Be sure to note the 5' and 3' ends.

Your answer:


c.     What is the protein?

Your answer:


d.     Explain how, in your answers to questions 3a and 3b, you obtained the sequences listed from the RNA sequence.

Your answer:


C. Translation


     



1.     The following is a section from the template strand of DNA, which contains a nucleotide sequence encoding for the protein identified in the answer to question 3c from the Transcription activity above:

CCCTATCATCTTGTTACGACACGGAGTCATACGAGGAATATGGTTAATCTCTTGATAACGTTA

a.     What is the informational sequence that is complimentary to this sequence?

Your answer:


b.     What is the mRNA that will be transcribed from this sequence?

Your answer:


c.     What is the amino acid sequence for this protein? (To convert the order of the nucleotides into the proper order of amino acids in the protein, be sure to use the genetic code -- go to the lab itself for access.)

Your answer:



2.     Produce a nucleotide sequence with a single base-pair substitution mutation that still produces the same amino acid sequence. Indicate the site of the mutation and explain why the amino acid sequence is not affected.

Your answer:
Submitted: 9 years ago.
Category: Homework

Related Homework Questions